Stem-loop sequence bmo-mir-10

AccessionMI0004973 (change log)
DescriptionBombyx mori miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

8 open access papers mention bmo-mir-10
(26 sentences)

Stem-loop
   a    c      cu   -  g    u           ugaa 
5'  gugc cuacau  acc cu uaga ccgaauuuguu    g
    |||| ||||||  ||| || |||| |||||||||||    u
3'  cacg ggugug  ugg ga aucu ggcuuaaacag    g
   g    u      uu   a  g    u           cgga 
Get sequence
Deep sequencing
11959 reads, 1.5e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Tong et al erroneously published the reverse complement of the sequence shown here [1].

Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582018.1: 2516858-2516941 [-]
intergenic
Database links

Mature sequence bmo-miR-10-5p

Accession MIMAT0004195
Previous IDsbmo-miR-10
Sequence

15 - 

acccuguagauccgaauuugu

 - 35

Get sequence
Deep sequencing3453 reads, 3 experiments
Evidence experimental; cloned [3], RT-PCR [4], Illumina [5]
Database links

Mature sequence bmo-miR-10-3p

Accession MIMAT0015226
Previous IDsbmo-miR-10*
Sequence

50 - 

caaauucgguucuagagagguuu

 - 72

Get sequence
Deep sequencing8505 reads, 3 experiments
Evidence experimental; Illumina [5]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).