Stem-loop sequence bmo-mir-9a

AccessionMI0004972
Previous IDsbmo-mir-9
DescriptionBombyx mori miR-9a stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a      u   uaa   u       u        g     -  au 
5'  guagau ggu   uua cuuuggu aucuagcu uauga gu  u
    |||||| |||   ||| ||||||| |||||||| ||||| ||  a
3'  caucug ccg   aau gaggcca uggaucga auacu ca  c
   a      -   -ug   u       u        a     g  gu 
Get sequence
Deep sequencing
2189 reads, 516 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2527: 9274-9363 [-]
intergenic

Mature sequence bmo-miR-9a-5p

Accession MIMAT0004194
Previous IDsbmo-miR-9;bmo-miR-9a
Sequence

18 - 

ucuuugguuaucuagcuguauga

 - 40

Get sequence
Deep sequencing1823 reads, 3 experiments
Evidence experimental; Northern [2], cloned [3], RT-PCR [4], Illumina [5]

Mature sequence bmo-miR-9a-3p

Accession MIMAT0015225
Previous IDsbmo-miR-9a*
Sequence

55 - 

auaaagcuagguuaccggaguua

 - 77

Get sequence
Deep sequencing85 reads, 3 experiments
Evidence experimental; Illumina [5]

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).