Stem-loop sequence bmo-mir-7

AccessionMI0004970 (change log)
DescriptionBombyx mori miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

6 open access papers mention bmo-mir-7
(16 sentences)

Stem-loop
   c   -    g     u  a   c         --    -   uu 
5'  gcu ucgu uugua gg aga uagugauuu  uguu guu  u
    ||| |||| ||||| || ||| |||||||||  |||| |||   
3'  cga agcg aacau cc ucu aucacuaaa  acaa cag  g
   a   c    a     -  g   a         ga    u   uu 
Get sequence
Deep sequencing
4066 reads, 667 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582035.1: 2817062-2817146 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-7
bmo-mir-2758NW_004582035.1: 2816104-2816179 [+]
bmo-mir-7NW_004582035.1: 2817062-2817146 [+]
Database links

Mature sequence bmo-miR-7-5p

Accession MIMAT0004192
Previous IDsbmo-miR-7
Sequence

15 - 

uggaagacuagugauuuuguugu

 - 37

Get sequence
Deep sequencing4062 reads, 3 experiments
Evidence experimental; cloned [3], RT-PCR [4], Illumina [5]
Database links

Mature sequence bmo-miR-7-3p

Accession MIMAT0015223
Previous IDsbmo-miR-7*
Sequence

52 - 

aagaaaucacuaaucugccua

 - 72

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [5]

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).