Stem-loop sequence bmo-let-7

AccessionMI0004968 (change log)
DescriptionBombyx mori let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

11 open access papers mention bmo-let-7
(167 sentences)

Stem-loop
   g  acug           uu   g                a  g aa  ca 
5'  gu    ccgucggcuug  gag uaguagguuguauagu cg a  ua  a
    ||    |||||||||||  ||| |||||||||||||||| || |  ||  c
3'  ca    ggcagucgagc  uuc aucguccgauauguca gc u  au  a
   a  guaa           cu   a                -  g gg  ac 
Get sequence
Deep sequencing
105422 reads, 1.8e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582019.1: 3373685-3373788 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-let-7
bmo-mir-100NW_004582019.1: 3376172-3376313 [-]
bmo-mir-2795NW_004582019.1: 3375941-3376015 [-]
bmo-let-7NW_004582019.1: 3373685-3373788 [-]
Database links

Mature sequence bmo-let-7-5p

Accession MIMAT0004190
Previous IDsbmo-let-7
Sequence

20 - 

ugagguaguagguuguauagu

 - 40

Get sequence
Deep sequencing105327 reads, 3 experiments
Evidence experimental; Northern [1-3], RT-PCR [4], Illumina [5]
Database links

Mature sequence bmo-let-7-3p

Accession MIMAT0015221
Previous IDsbmo-let-7*
Sequence

66 - 

cuguauagccugcuaacuuucc

 - 87

Get sequence
Deep sequencing35 reads, 3 experiments
Evidence experimental; Illumina [5]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:17651473 "Characterization and expression patterns of let-7 microRNA in the silkworm (Bombyx mori)" Liu S, Xia Q, Zhao P, Cheng T, Hong K, Xiang Z BMC Dev Biol. 7:88(2007).
3
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
4
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).