Stem-loop sequence mmu-mir-652

AccessionMI0004965 (change log)
Symbol MGI:Mir652
DescriptionMus musculus miR-652 stem-loop
Gene family MIPF0000333; mir-652
Literature search

12 open access papers mention mmu-mir-652
(22 sentences)

Stem-loop
   aggaaca   a                  gaggg           ca  g 
5'        gcu uguacugcacaacccuag     ggugccauuca  ua a
          ||| ||||||||||||||||||     |||||||||||  || g
3'        cga augugacguguugggauc     ccgcgguaagu  au u
   -cacauc   c                  ----a           ua  a 
Get sequence
Deep sequencing
128511 reads, 521 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 142739000-142739097 [+]
sense
OTTMUST00000045328 ; Tmem164-003; intron 1
OTTMUST00000045330 ; Tmem164-005; intron 1
OTTMUST00000045329 ; Tmem164-004; intron 1
OTTMUST00000045377 ; Tmem164-009; intron 1
OTTMUST00000045311 ; Tmem164-001; intron 2
OTTMUST00000045331 ; Tmem164-002; intron 2
OTTMUST00000045310 ; Tmem164-007; intron 2
ENSMUST00000112889 ; Tmem164-003; intron 1
ENSMUST00000101198 ; Tmem164-005; intron 1
ENSMUST00000112891 ; Tmem164-004; intron 1
ENSMUST00000124211 ; Tmem164-009; intron 1
ENSMUST00000087333 ; Tmem164-001; intron 2
ENSMUST00000112896 ; Tmem164-002; intron 2
ENSMUST00000133634 ; Tmem164-007; intron 2
Database links

Mature sequence mmu-miR-652-5p

Accession MIMAT0017260
Previous IDsmmu-miR-652*
Sequence

21 - 

caacccuaggagggggugccauuc

 - 44

Get sequence
Deep sequencing423 reads, 68 experiments
Evidence experimental; 454 [4], Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-652-3p

Accession MIMAT0003711
Previous IDsmmu-miR-652
Sequence

61 - 

aauggcgccacuaggguugug

 - 81

Get sequence
Deep sequencing128013 reads, 107 experiments
Evidence experimental; cloned [2], Illumina [3,5]
Database links
Predicted targets

References

1
PMID:16566924 "Identification of new central nervous system specific mouse microRNAs" Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T FEBS Lett. 580:2195-2200(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).