Stem-loop sequence xtr-mir-196b

Accession MI0004943
Description Xenopus tropicalis miR-196b stem-loop
Gene family MIPF0000031; mir-196
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-196_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553). miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ag      -       u          a      u   cauuc 
  ccgcug ugugguu agguaguuuu uguugu ggg     a
  |||||| ||||||| |||||||||| |||||| |||     c
  ggugac acauuaa uccgucaaag acaaca cuc     c
-g      u       u          a      u   ucuuu 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172692.1: 1411039-1411125 [+]
intergenic

Mature sequence xtr-miR-196b

Accession MIMAT0003691
Sequence

16 - 

uagguaguuuuauguuguugg

 - 36

Get sequence
Evidence by similarity; MI0000279
Predicted targets