Stem-loop sequence xtr-let-7e-2

Accession MI0004909
Description Xenopus tropicalis let-7e-2 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--   -   ug   u   gu          u       ----------   u 
  gcc cuu  ggg gag  aguagguugu uaguugu          ggg u
  ||| |||  ||| |||  |||||||||| |||||||          ||| g
  cgg gaa  ccu uuc  ucaucuaaca aucaaua          ccc c
gu   u   gu   -   ug          u       gguuugcagu   a 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173544.1: 26197-26289 [+]
intergenic

Mature sequence xtr-let-7e

Accession MIMAT0003666
Sequence

12 - 

ugagguaguagguuguuuaguu

 - 33

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1