Stem-loop sequence xtr-let-7a

Accession MI0004908
Description Xenopus tropicalis let-7a stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gu          cu       u              aggauaac 
  gggcuccagg  gagguag agguuguauaguug        a
  ||||||||||  ||||||| ||||||||||||||        c
  uucggggucc  uucuauc uccgacaugucaau        c
--          cu       c              agaggaaa 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172961.1: 948723-948811 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-let-7a
xtr-mir-100 GL172961.1: 946793-946868 [+]
xtr-let-7a GL172961.1: 948723-948811 [+]

Mature sequence xtr-let-7a

Accession MIMAT0003667
Sequence

14 - 

ugagguaguagguuguauaguu

 - 35

Get sequence
Evidence by similarity; MI0000828
Predicted targets