Stem-loop sequence xtr-mir-148a

Accession MI0004905
Description Xenopus tropicalis miR-148a stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u        u            --a    ua    -   aa 
uag cuuuuaaa caaaguucugug   cacu  gacu cug  u
||| |||||||| ||||||||||||   ||||  |||| |||  a
guc gaggguuu guuucaagacau   guga  cuga gau  u
   u        u            cac    --    c   ag 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172692.1: 2016829-2016914 [+]
intergenic

Mature sequence xtr-miR-148a

Accession MIMAT0003664
Sequence

53 - 

ucagugcacuacagaacuuugu

 - 74

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1