Stem-loop sequence xtr-mir-15c

AccessionMI0004892 (change log)
DescriptionXenopus tropicalis miR-15c stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   cuuugaggugaucua     a  uc          gaaac 
5'                gcagc ca  augguuugua     a
                  ||||| ||  ||||||||||      
3'                cgucg gu  uaccagacau     a
   --------aguucuc     a  cu          agagg 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 47368665-47368738 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-15c
xtr-mir-15cchr8: 47368665-47368738 [-]
xtr-mir-16cchr8: 47366673-47366742 [-]
Database links

Mature sequence xtr-miR-15c

Accession MIMAT0003651
Sequence

14 - 

uagcagcacaucaugguuugua

 - 35

Get sequence
Evidence by similarity; MI0000564
Predicted targets