Stem-loop sequence xtr-mir-218-1

Accession MI0004871
Description Xenopus tropicalis miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ug   ac   --   a   u      u         cu        gguugugag 
  gua  aag  gcg gau uucugu gugcuugau  aaccaugu         g
  |||  |||  ||| ||| |||||| |||||||||  ||||||||          
  cau  uuc  cgc cug aaggua cacgaacug  uugguaca         u
-a   cu   ga   a   c      c         uc        aaaugagua 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172867.1: 380388-380496 [+]
sense

Mature sequence xtr-miR-218

Accession MIMAT0003631
Sequence

24 - 

uugugcuugaucuaaccaugu

 - 44

Get sequence
Evidence by similarity; MI0000958
Predicted targets