|
miRBase |
|
Stem-loop sequence xtr-mir-133c |
|||||||||||||||||||||||||||||||||||||||||||
| Accession | MI0004835 | ||||||||||||||||||||||||||||||||||||||||||
| Description | Xenopus tropicalis miR-133c stem-loop | ||||||||||||||||||||||||||||||||||||||||||
| Gene family | MIPF0000029; mir-133 | ||||||||||||||||||||||||||||||||||||||||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours. Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages: You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages. Please note, we're not responsible for the content of Wikipedia pages. You can read more about miRBase, Wikipedia and community annotation on this blog post. Please email us for help or with comments about this community annotation initiative. mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.
mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice.[1] Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.[2]
[edit] RegulationIt is proposed that Insulin activates the translocation of SREBP-1c (BHLH) active form from the endoplasmic reticulum (ER) to the nucleus and, concomittantly, induces SREPB-1c expression via PI3K signaling pathway. SREBP-1c mediates MEF2C downregulation through a mechanism that remains to be determined. As a consequence of lower MEF2C binding on their enhancer region, the transcription of miR-1 and miR-133a is reduced, leading to decreased levels of their mature forms in muscle, after insulin treatment. Altered activation of PI3K and SREBP-1c may explain the defective regulation of miR-1 and miR-133a expression in response to insulin in muscle of type 2 diabetic patients.[3] [edit] Targets of miR-133microRNAs act by lowering the expression of genes by binding to target sites in the 3' UTR of the mRNAs. Luo et al.. demonstrated that the HCN2 K+ channel gene contains a target of miR-133.[4] Yin et al.. showed that the Mps1 kinase gene in zebrafish is a target.[5] Luo et al.. demonstrated that the voltage gated K+ channel KCNQ1 is a target.[6] Boutz et al.. showed that nPTB (neuronal polypyrimidine tract-binding protein) is a target and likely contains two target sites for miR-133.[7] Xiao et al.. show that ether-a-go-go related gene (ERG) a K+ channel is a target of miR-133.[8] miR-133 directly and negatively regulates NFATc4.[9][10] RhoA expression is negatively regulated by miR-133a in bronchial smooth muscles (BSM)and miR-133a downregulation causes an upregulation of RhoA, resulting in an augmentation of contraction and BSM hyperresponsiveness.[11] BMP2 downregulates multiple mIRs, of which one, miR-133, directly inhibits Runx2, an early BMP response gene essential for bone formation. Although miR-133 is known to promote MEF-2-dependent myogenesis, it also inhibits Runx2-mediated osteogenesis. BMP2 controls bone cell determination by inducing miRNAs that target muscle genes but mainly by down-regulating multiple miRNAs that constitute an osteogenic program, thereby releasing from inhibition pathway components required for cell lineage commitment establish a mechanism for BMP morphogens to selectively induce a tissue-specific phenotype and suppress alternative lineages.[12] Nicotine activates α7-nAChR and downregulates the levels of miR-133 and miR-590 leading to significant upregulation of expression of TGF-β1 and TGF-βRII at the protein level establishing miR-133 and miR-590 as repressors of TGF-β1 and TGF-βRII.[13] miR-133 enhances myoblast proliferation by repressing serum response factor (SRF)[14] mIR-133 supressses SP1 expression[15] In rats, miR-133b is expressed in retinal dopaminergicamacrine cell, and this expression is significantly increased during early stage during retinal degeneration. This overexpression leads to downregulation of the transcription factor PITX3.[16] [edit] References
[edit] Further reading
[edit] External links
|
||||||||||||||||||||||||||||||||||||||||||
| Stem-loop |
-- uuu aa aa u a aacug aaugc gcu agcuggu aa gg accaaauc u ||||| ||| ||||||| || || |||||||| uuacg cga ucgacca uu cc ugguuuag u ag ugu cg ac c c guaagGet sequence |
||||||||||||||||||||||||||||||||||||||||||
| Genome context |
|
||||||||||||||||||||||||||||||||||||||||||
Mature sequence xtr-miR-133c |
|
| Accession | MIMAT0003595 |
| Sequence |
52 - uugguccccuucaaccagcugc - 73 |
| Evidence | by similarity; MI0001992 |
| Predicted targets |
|
Comments, questions? Email mirbase@manchester.ac.uk