Stem-loop sequence xtr-mir-130b

Accession

MI0004833

Description

Xenopus tropicalis miR-130b stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Stem-loop

cc c    ca       cc         a  g  gca 
  g cuga  cucuuuc  uguugcacu cu ug   g
  | ||||  |||||||  ||||||||| || ||    
  c gacu  gggaaag  guaacguga ga au   u
gu u    ac       ua         c  a  aag 

Genome context

• Coordinates (JGI4.2): GL172648.1: 3575983-3576058 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from xtr-mir-130b

• xtr-mir-130c: GL172648.1: 3568249-3568319 [+]
• xtr-mir-301-2: GL172648.1: 3569092-3569164 [+]
• xtr-mir-130b: GL172648.1: 3575983-3576058 [+]

Mature sequence xtr-miR-130b

• Accession: MIMAT0003593
• Sequence: 48 - cagugcaaugaugaaagggcau - 69
• Evidence: by similarity; MI0001986
• Predicted targets:
  • TARGETSCAN-VERT:xtr-miR-130b