Stem-loop sequence xtr-mir-34a

Accession MI0004816
Description Xenopus tropicalis miR-34a stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-c    -  ug     uu        c  a            gg acg 
  ugug ag  uuucu  ggcagugu uu gcugguuguugu  c   u
  |||| ||  |||||  |||||||| || ||||||||||||  |    
  acac uc  gaaga  ccgucaua aa cgacuaacgaug  g   u
uu    g  uu     uc        u  a            aa aua 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172843.1: 56384-56479 [+]
intergenic

Mature sequence xtr-miR-34a

Accession MIMAT0003578
Sequence

16 - 

uggcagugucuuagcugguuguu

 - 38

Get sequence
Evidence by similarity; MI0000268
Predicted targets