Stem-loop sequence xtr-mir-30c-1

Accession MI0004815
Description Xenopus tropicalis miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a     ca    u auu           aca        ug gaa 
 ccaug  gcag g   guaaacauccu   cucucagc  u   c
 |||||  |||| |   |||||||||||   ||||||||  |   a
 gguac  cguc c   cauuuguggga   gagggucg  g   u
a     --    c ccu           --a        gu gaa 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173013.1: 513152-513240 [-]
sense
ENSXETT00000054158 ; NP_989205.1; intron 5
ENSXETT00000054158 ; NP_989205.1; intron 5
Clustered miRNAs
< 10kb from xtr-mir-30c-1
xtr-mir-30e GL173013.1: 514155-514244 [-]
xtr-mir-30c-1 GL173013.1: 513152-513240 [-]

Mature sequence xtr-miR-30c

Accession MIMAT0003577
Sequence

17 - 

uguaaacauccuacacucucagc

 - 39

Get sequence
Evidence by similarity; MI0000736
Predicted targets