Stem-loop sequence xtr-mir-10c

Accession MI0004798
Description Xenopus tropicalis miR-10c stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--       a    g    au          ugagu 
  uauaugc cccu uaga  cgaauuugug     u
  ||||||| |||| ||||  ||||||||||      
  guauaug gggg aucu  gcuuagacac     c
gg       -    g    cu          caagu 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172862.1: 460977-461047 [+]
intergenic

Mature sequence xtr-miR-10c

Accession MIMAT0003559
Sequence

7 - 

cacccuguagaaucgaauuugu

 - 28

Get sequence
Evidence by similarity; MI0000267
Predicted targets