Stem-loop sequence xtr-mir-7-2

Accession MI0004792
Description Xenopus tropicalis miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

This family represents the microRNA (miRNA) precursor mir-7. This miRNA has been predicted or experimentally confirmed in a wide range of species. miRNAs are transcribed as ~70 nucleotide precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. Mature miRNA-7 is derived from three microRNA precursors in the human genome, miR-7-1, miR-7-2 and miR-7-3. miRNAs are numbered based on the sequence of the mature RNA. miR-7 is directly regulated by the transcription factor HoxD10. miRNAs are thought to have regulatory roles through complementarity to mRNA. miR-7 is essential for the maintenance of regulatory stability under conditions of environmental flux. It plays an important role in controlling mRNA expression. The miR-7 gene is found in most sequenced Urbilateria species, and the sequence of its mature miRNA product is perfectly conserved from annelids to humans, indicating a strong functional conservation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ga    cag    -a u  u  u  a     a       u     --     gc 
  ggug   gcug  c cu ug gg agacu gugauuu guugu  uguaa  c
  ||||   ||||  | || || || ||||| ||||||| |||||  |||||   
  cuau   cgac  g ga ac cc ucuga cacugaa caaca  acguu  u
-a    -aa    cc u  c  u  g     -       -     gu     au 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172658.1: 1242937-1243039 [+]
sense
ENSXETT00000016519 ; NP_001072399.2; intron 1
ENSXETT00000016519 ; NP_001072399.2; intron 1

Mature sequence xtr-miR-7

Accession MIMAT0003552
Sequence

22 - 

uggaagacuagugauuuuguug

 - 43

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1