Stem-loop sequence dre-mir-735

AccessionMI0004781 (change log)
DescriptionDanio rerio miR-735 stem-loop
Literature search

3 open access papers mention dre-mir-735
(12 sentences)

Stem-loop
           --cgaa         uu  ucuu 
5' ggcugguc      ggcgguggg  ag    c
   ||||||||      |||||||||  ||    u
3' cugaccag      ucgccaccc  uc    c
           uucaaa         uc  cccu 
Get sequence
Deep sequencing
12706 reads, 627 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr24: 38177965-38178027 [-]
sense
OTTDART00000012515 ; si:ch211-234p6.7-001; intron 1
ENSDART00000109975 ; crp7-001; intron 1
ENSDART00000121286 ; Y_RNA.2-201; exon 1
antisense
OTTDART00000050159 ; si:ch211-234p6.5-001; intron 14
ENSDART00000105668 ; PLEKHA4-201; intron 13
ENSDART00000152019 ; PLEKHA4-001; intron 14
Database links

Mature sequence dre-miR-735-5p

Accession MIMAT0032012
Sequence

1 - 

ggcugguccgaaggcggu

 - 18

Get sequence
Deep sequencing11949 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-735-3p

Accession MIMAT0003766
Previous IDsdre-miR-735
Sequence

37 - 

cucucccaccgcuaaacuugac

 - 58

Get sequence
Deep sequencing749 reads, 9 experiments
Evidence experimental; cloned [1], in-situ [1], Northern [1]
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).