Stem-loop sequence dre-mir-734

AccessionMI0004780 (change log)
DescriptionDanio rerio miR-734 stem-loop
Gene family MIPF0001543; mir-734
Literature search

2 open access papers mention dre-mir-734
(2 sentences)

Stem-loop
   u     ug     u a  c            ggc     gugga   u 
5'  gauau  agagc g ac auucugcagcau   ugccu     ucc c
    |||||  ||||| | || ||||||||||||   |||||     ||| u
3'  cuaug  ucuug c ug uaagacgucgua   augga     agg g
   a     gu     c a  c            --a     ----a   g 
Get sequence
Deep sequencing
96 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 34122880-34122972 [+]
sense
OTTDART00000030233 ; epha6-001; intron 3
ENSDART00000146530 ; epha6-001; intron 3
ENSDART00000042984 ; epha6-201; intron 3
KZ114845.1: 145395-145487 [+]
sense
OTTDART00000030233 ; epha6-001; intron 3
ENSDART00000146530 ; epha6-001; intron 3
ENSDART00000042984 ; epha6-201; intron 3
KZ115032.1: 270388-270480 [+]
sense
OTTDART00000030233 ; epha6-001; intron 3
ENSDART00000146530 ; epha6-001; intron 3
ENSDART00000042984 ; epha6-201; intron 3
Database links

Mature sequence dre-miR-734

Accession MIMAT0003765
Sequence

59 - 

guaaaugcugcagaaucguaccg

 - 81

Get sequence
Deep sequencing95 reads, 11 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).