Stem-loop sequence dre-mir-34c

AccessionMI0004774 (change log)
DescriptionDanio rerio miR-34c stem-loop
Gene family MIPF0000039; mir-34
Literature search

10 open access papers mention dre-mir-34c
(32 sentences)

Stem-loop
        u  gg     a  c    ca      u      aauc 
5' ugcug gu  ucacc gg agug  guuagu gauuac    c
   ||||| ||  ||||| || ||||  |||||| ||||||     
3' augau cg  agugg cc ucac  caauca cuaaug    a
        -  ga     a  a    uc      -      aaau 
Get sequence
Deep sequencing
567 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 57922284-57922367 [-]
intergenic
KZ115154.1: 111474-111557 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-34c
dre-mir-34bchr5: 57922520-57922604 [-]
dre-mir-34cchr5: 57922284-57922367 [-]
Database links

Mature sequence dre-miR-34c-5p

Accession MIMAT0003759
Previous IDsdre-miR-34c
Sequence

16 - 

aggcagugcaguuaguugauuac

 - 38

Get sequence
Deep sequencing520 reads, 5 experiments
Evidence experimental; cloned [1], in-situ [1], Northern [1]
Database links
Predicted targets

Mature sequence dre-miR-34c-3p

Accession MIMAT0032011
Sequence

51 - 

aaucacuaaccucacuaccagg

 - 72

Get sequence
Deep sequencing47 reads, 5 experiments
Evidence not experimental
Database links

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).