Stem-loop sequence dre-mir-726

AccessionMI0004770 (change log)
DescriptionDanio rerio miR-726 stem-loop
Gene family MIPF0001344; mir-726
Literature search

2 open access papers mention dre-mir-726
(6 sentences)

Stem-loop
        c     c    aa   c      uc      a  c  g 
5' ucagu guaug cugg  uuc gcuagu  ugaacu uu gu a
   ||||| ||||| ||||  ||| ||||||  |||||| || || u
3' aguca cauau ggcu  aag cgauca  acuuga aa cg u
        a     a    -c   a      uc      a  -  g 
Get sequence
Deep sequencing
114 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr11: 25476099-25476185 [-]
intergenic
KZ115359.1: 101986-102072 [-]
intergenic
Database links

Mature sequence dre-miR-726

Accession MIMAT0003754
Sequence

55 - 

uucacuacuagcagaacucgg

 - 75

Get sequence
Deep sequencing100 reads, 9 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).