Stem-loop sequence dre-mir-725

AccessionMI0004769 (change log)
Previous IDsdre-mir-725
DescriptionDanio rerio miR-725 stem-loop
Gene family MIPF0001355; mir-725
Literature search

4 open access papers mention dre-mir-725
(7 sentences)

Stem-loop
            a            ug           gaag 
5' cugcagugc cauugcuaggaa  guggcugagau    a
   ||||||||| ||||||||||||  |||||||||||     
3' gacgucgcg gugaugaucuuu  uacugacuuua    g
            c            gu           ggac 
Get sequence
Deep sequencing
72646 reads, 3.84e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr22: 24366193-24366272 [-]
intergenic
KZ114977.1: 428804-428883 [-]
intergenic
Database links

Mature sequence dre-miR-725-5p

Accession MIMAT0032010
Sequence

14 - 

ugcuaggaaugguggcugagau

 - 35

Get sequence
Deep sequencing577 reads, 11 experiments
Evidence not experimental

Mature sequence dre-miR-725-3p

Accession MIMAT0003753
Previous IDsdre-miR-725
Sequence

48 - 

uucagucauuguuucuaguagu

 - 69

Get sequence
Deep sequencing72068 reads, 11 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).