Stem-loop sequence dre-mir-724

AccessionMI0004768 (change log)
DescriptionDanio rerio miR-724 stem-loop
Gene family MIPF0001616; mir-724
Literature search

3 open access papers mention dre-mir-724
(6 sentences)

Stem-loop
         a u      -        uu  c a     agu ag 
5' cagcag c ggauuu aaagggaa  ug g cuguu   c  a
   |||||| | |||||| ||||||||  || | |||||   |   
3' gucguc g ucuaga uuuuccuu  ac c gacaa   g  u
         c u      a        cc  a c     gau uu 
Get sequence
Deep sequencing
1915 reads, 72.7 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr11: 3176686-3176770 [+]
sense
OTTDART00000028834 ; cpne5-001; intron 11
ENSDART00000050098 ; cpne5-001; intron 11
ENSDART00000126071 ; cpne5-202; intron 17
ENSDART00000104503 ; cpne5-201; intron 18
Database links

Mature sequence dre-miR-724

Accession MIMAT0003752
Sequence

14 - 

uuaaagggaauuugcgacuguu

 - 35

Get sequence
Deep sequencing1885 reads, 11 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).