Stem-loop sequence dre-mir-722

AccessionMI0004765 (change log)
DescriptionDanio rerio miR-722 stem-loop
Gene family MIPF0001612; mir-722
Literature search

2 open access papers mention dre-mir-722
(70 sentences)

Stem-loop
                              g  c      g ---a  c 
5' ggaacggaguggaauuugaaacguuuu gc aaaaau u    gc a
   ||||||||||||||||||||||||||| || |||||| |    ||  
3' ucuugccucgcuuuagacuuugcaaag cg uuuuug g    cg u
                              a  u      g gaaa  g 
Get sequence
Deep sequencing
908 reads, 18.2 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 56363884-56363974 [-]
intergenic
Database links

Mature sequence dre-miR-722

Accession MIMAT0003748
Sequence

56 - 

uuuuuugcagaaacguuucagauu

 - 79

Get sequence
Deep sequencing845 reads, 10 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).