Stem-loop sequence dre-mir-190b

AccessionMI0004764 (change log)
DescriptionDanio rerio miR-190b stem-loop
Gene family MIPF0000076; mir-190
Literature search

5 open access papers mention dre-mir-190b
(9 sentences)

Stem-loop
   u       a    - ug              cg    - uuucuu 
5'  guuacag cuau g  auauguuugauauu  guug c      u
    ||||||| |||| |  ||||||||||||||  |||| |       
3'  caguguc gaua c  uauacagacuauaa  caac g      a
   a       a    u cu              au    u uacuau 
Get sequence
Deep sequencing
546 reads, 33.3 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 17705898-17705987 [-]
intergenic
Database links

Mature sequence dre-miR-190b

Accession MIMAT0003747
Sequence

15 - 

ugauauguuugauauucgguug

 - 36

Get sequence
Deep sequencing546 reads, 9 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).