Stem-loop sequence bta-mir-34b

AccessionMI0004763 (change log)
DescriptionBos taurus miR-34b stem-loop
Gene family MIPF0000039; mir-34
Literature search

9 open access papers mention bta-mir-34b
(61 sentences)

Stem-loop
        cg    -gua       u      c        cu u 
5' gugcu  guuu    ggcagug aauuag ugauugua  c c
   |||||  ||||    ||||||| |||||| ||||||||  |  
3' cacgg  caaa    ccgucac uugauc acuaacau  g a
        aa    acua       c      -        uc u 
Get sequence
Deep sequencing
448 reads, 1.82 reads per million, 55 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 22281681-22281764 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-34b
bta-mir-34bchr15: 22281681-22281764 [+]
bta-mir-34cchr15: 22282382-22282458 [+]
Database links

Mature sequence bta-miR-34b

Accession MIMAT0003549
Sequence

14 - 

aggcaguguaauuagcugauug

 - 35

Get sequence
Deep sequencing407 reads, 52 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).