Stem-loop sequence bta-mir-205

AccessionMI0004759 (change log)
DescriptionBos taurus miR-205 stem-loop
Gene family MIPF0000058; mir-205
Literature search

16 open access papers mention bta-mir-205
(54 sentences)

Stem-loop
         uc           c        ucucg 
5' cucuug  cuucauuccac ggagucug     u
   ||||||  ||||||||||| ||||||||     a
3' gaggac  gaagugaggug cuuuagac     c
         uu           a        caacc 
Get sequence
Deep sequencing
214266 reads, 3.5e+03 reads per million, 45 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 76053046-76053114 [-]
intergenic
Database links

Mature sequence bta-miR-205

Accession MIMAT0003545
Sequence

7 - 

uccuucauuccaccggagucug

 - 28

Get sequence
Deep sequencing214182 reads, 44 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2