Stem-loop sequence bta-mir-181a-2

AccessionMI0004757 (change log)
Previous IDsbta-mir-181a-2;bta-mir-181a
DescriptionBos taurus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

33 open access papers mention bta-mir-181a-2
(238 sentences)

Stem-loop
   ugccagggccaggacccagucuuca     cu      a   u      cu       a    ggga 
5'                          gagga  ccaagg aca ucaacg  gucggug guuu    u
                            |||||  |||||| ||| ||||||  ||||||| ||||    u
3'                          uuccu  gguucc ugu aguugc  cagccac caaa    u
   ------------------------a     ug      a   c      --       -    aaag 
Get sequence
Deep sequencing
988872 reads, 1.04e+04 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 95966066-95966175 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-181a-2
bta-mir-181a-2chr11: 95966066-95966175 [+]
bta-mir-181b-2chr11: 95967281-95967369 [+]
Database links

Mature sequence bta-miR-181a

Accession MIMAT0003543
Sequence

39 - 

aacauucaacgcugucggugaguu

 - 62

Get sequence
Deep sequencing1960794 reads, 78 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2