Stem-loop sequence bta-mir-145

AccessionMI0004756 (change log)
DescriptionBos taurus miR-145 stem-loop
Gene family MIPF0000079; mir-145
Literature search

19 open access papers mention bta-mir-145
(53 sentences)

Stem-loop
   c   u  u     c  uc    u  c            uagau 
5'  acc ug ccuca gg  cagu uu ccaggaaucccu     g
    ||| || ||||| ||  |||| || ||||||||||||     c
3'  ugg ac ggagu uc  guca aa gguccuuagggg     u
   u   u  u     -  uu    u  a            uagaa 
Get sequence
Deep sequencing
248975 reads, 1.87e+03 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 63080500-63080587 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-145
bta-mir-143chr7: 63079071-63079171 [+]
bta-mir-145chr7: 63080500-63080587 [+]
Database links

Mature sequence bta-miR-145

Accession MIMAT0003542
Sequence

16 - 

guccaguuuucccaggaaucccu

 - 38

Get sequence
Deep sequencing195193 reads, 66 experiments
Evidence experimental; cloned [1-3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3