Stem-loop sequence bta-mir-126

AccessionMI0004754 (change log)
DescriptionBos taurus miR-126 stem-loop
Gene family MIPF0000115; mir-126
Literature search

22 open access papers mention bta-mir-126
(144 sentences)

Stem-loop
   u     - a           u       c cug   c 
5'  gacgg g cauuauuacuu ugguacg g   uga a
    ||||| | ||||||||||| ||||||| |   |||  
3'  cuguc c guaauaaugag gccaugc c   acu c
   a     g -           u       u -aa   u 
Get sequence
Deep sequencing
611311 reads, 6.6e+03 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 104385546-104385618 [+]
intergenic
Database links

Mature sequence bta-miR-126-5p

Accession MIMAT0004328
Previous IDsbta-miR-126*
Sequence

9 - 

cauuauuacuuuugguacgcg

 - 29

Get sequence
Deep sequencing503370 reads, 65 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence bta-miR-126-3p

Accession MIMAT0003540
Previous IDsbta-miR-126
Sequence

47 - 

cguaccgugaguaauaaugcg

 - 67

Get sequence
Deep sequencing107900 reads, 64 experiments
Evidence experimental; cloned [1-3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3