|
miRBase |
|
Stem-loop sequence bta-mir-125b-1 |
|||||
| Accession | MI0004753 | ||||
| Previous IDs | bta-mir-125b | ||||
| Description | Bos taurus miR-125b-1 stem-loop | ||||
| Gene family | MIPF0000017; mir-125 | ||||
| Stem-loop |
c c u -a u c au c gcgcg cuc ca uccc gaga ccuaacuugug guuua c ||||| ||| || |||| |||| ||||||||||| ||||| g cgcgc gag gu aggg uucu ggauugggcac uaaau u c u c cg - c -c u |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence bta-miR-125b |
|
| Accession | MIMAT0003539 |
| Sequence |
15 - ucccugagacccuaacuuguga - 36 |
| Evidence | experimental; cloned [1-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
| 2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
| 3 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|