Stem-loop sequence bta-mir-99a

AccessionMI0004751 (change log)
DescriptionBos taurus miR-99a stem-loop
Gene family MIPF0000033; mir-10
Literature search

22 open access papers mention bta-mir-99a
(44 sentences)

Stem-loop
   cc          a         uc   u      g  aag 
5'   cauuggcaua acccguaga  cga cuugug ug   u
     |||||||||| |||||||||  ||| |||||| ||    
3'   gugacugugu uggguaucu  gcu gaacac gc   g
   gu          c         uc   c      -  cag 
Get sequence
Deep sequencing
126400 reads, 2.61e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 19985570-19985650 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-99a
bta-mir-99achr1: 19985570-19985650 [-]
bta-let-7cchr1: 19984844-19984927 [-]
Database links

Mature sequence bta-miR-99a-5p

Accession MIMAT0003537
Previous IDsbta-miR-99a
Sequence

13 - 

aacccguagauccgaucuugu

 - 33

Get sequence
Deep sequencing123587 reads, 78 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

Mature sequence bta-miR-99a-3p

Accession MIMAT0012533
Previous IDsbta-miR-99a*
Sequence

50 - 

caagcucgcuucuaugggu

 - 68

Get sequence
Deep sequencing2813 reads, 68 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3