Stem-loop sequence bta-mir-499

AccessionMI0004750 (change log)
DescriptionBos taurus miR-499 stem-loop
Gene family MIPF0000173; mir-499
Literature search

9 open access papers mention bta-mir-499
(100 sentences)

Stem-loop
   --------------------       c   c  ua        a          acucc 
5'                     gggcggg ggc gu  agacuugc gugauguuua     u
                       ||||||| ||| ||  |||||||| ||||||||||     c
3'                     ccugccc ucg cg  ucugaacg cacuacaagu     u
   ugggacggguccgucgcacc       u   u  ug        a          gcacc 
Get sequence
Deep sequencing
543 reads, 1.54 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 65163834-65163936 [+]
sense
ENSBTAT00000039242 ; MYH7B-201; intron 18
Database links

Mature sequence bta-miR-499

Accession MIMAT0003536
Sequence

14 - 

uuaagacuugcagugauguuu

 - 34

Get sequence
Deep sequencing523 reads, 65 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).