Stem-loop sequence bta-mir-484

AccessionMI0004749 (change log)
DescriptionBos taurus miR-484 stem-loop
Gene family MIPF0000219; mir-484
Literature search

2 open access papers mention bta-mir-484
(14 sentences)

Stem-loop
      -   cuc       ucccgauaaaccucu 
5' guc agg   agucccc               a
   ||| |||   |||||||                
3' cgg ucc   ucggggg               a
      c   --a       gcccuuccagggaua 
Get sequence
Deep sequencing
13481 reads, 74.3 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 14245864-14245926 [+]
intergenic
Database links

Mature sequence bta-miR-484

Accession MIMAT0003535
Sequence

2 - 

ucaggcucaguccccucccgau

 - 23

Get sequence
Deep sequencing13479 reads, 74 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).