Stem-loop sequence bta-mir-30d

AccessionMI0004747 (change log)
DescriptionBos taurus miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

27 open access papers mention bta-mir-30d
(125 sentences)

Stem-loop
   guu  u         ccc           guacca 
5'    gu guaaacauc   gacuggaagcu      c
      || |||||||||   |||||||||||       
3'    cg cguuuguag   cugacuuucga      a
   cau  u         --a           aucgac 
Get sequence
Deep sequencing
1012581 reads, 3.44e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 8141427-8141496 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-30d
bta-mir-30dchr14: 8141427-8141496 [+]
bta-mir-30bchr14: 8145856-8145943 [+]
Database links

Mature sequence bta-miR-30d

Accession MIMAT0003533
Sequence

6 - 

uguaaacauccccgacuggaagcu

 - 29

Get sequence
Deep sequencing995246 reads, 78 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2