Stem-loop sequence bta-mir-27a

AccessionMI0004746 (change log)
DescriptionBos taurus miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

31 open access papers mention bta-mir-27a
(69 sentences)

Stem-loop
   uggccu    a  a         ug  u       g uccac 
5'       gggg gc gggcuuagc  cu gugagca g     a
         |||| || |||||||||  || ||||||| |      
3'       cccc cg cuugaaucg  ga cacuugu c     u
   ------    -  c         gu  -       g uaaac 
Get sequence
Deep sequencing
2478637 reads, 2.54e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 13046007-13046084 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-27a
bta-mir-23achr7: 13046186-13046258 [-]
bta-mir-27achr7: 13046007-13046084 [-]
bta-mir-24-2chr7: 13045858-13045929 [-]
Database links

Mature sequence bta-miR-27a-5p

Accession MIMAT0012532
Sequence

14 - 

agggcuuagcugcuugugagca

 - 35

Get sequence
Deep sequencing508 reads, 68 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence bta-miR-27a-3p

Accession MIMAT0003532
Previous IDsbta-miR-27a
Sequence

54 - 

uucacaguggcuaaguuccg

 - 73

Get sequence
Deep sequencing2478129 reads, 78 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).