Stem-loop sequence bta-mir-26b

AccessionMI0004745 (change log)
DescriptionBos taurus miR-26b stem-loop
Gene family MIPF0000043; mir-26
Literature search

18 open access papers mention bta-mir-26b
(34 sentences)

Stem-loop
   -u  -    ga   -   u        uc           u ug 
5'   gc ccgg  ccc agu caaguaau  aggauagguug g  c
     || ||||  ||| ||| ||||||||  ||||||||||| |   
3'   cg ggcc  ggg ucg guucauua  ucuuguccgac c  u
   cc  u    gg   c   -        cc           - ug 
Get sequence
Deep sequencing
2149464 reads, 2.42e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 107511785-107511869 [+]
sense
ENSBTAT00000011010 ; CTDSP1-201; intron 4
Database links

Mature sequence bta-miR-26b

Accession MIMAT0003531
Sequence

15 - 

uucaaguaauucaggauagguu

 - 36

Get sequence
Deep sequencing2148325 reads, 78 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2