Stem-loop sequence bta-mir-222

AccessionMI0004744 (change log)
DescriptionBos taurus miR-222 stem-loop
Gene family MIPF0000051; mir-221
Literature search

21 open access papers mention bta-mir-222
(62 sentences)

Stem-loop
   gcugcu  aau ugu    a  c   au              -     auc   ucuu 
5'       gg   g   aggu cc uca  ggcucaguagccag uguag   cug    u
         ||   |   |||| || |||  |||||||||||||| |||||   |||    u
3'       cc   c   ucua gg agu  cugggucaucgguc acauc   gac    g
   -----u  -au --u    c  u   cu              u     gau   uaau 
Get sequence
Deep sequencing
56061 reads, 277 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 104687960-104688069 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-222
bta-mir-222chrX: 104687960-104688069 [+]
bta-mir-221chrX: 104688654-104688763 [+]
Database links

Mature sequence bta-miR-222

Accession MIMAT0003530
Sequence

69 - 

agcuacaucuggcuacugggu

 - 89

Get sequence
Deep sequencing55992 reads, 69 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).