Stem-loop sequence bta-mir-221

AccessionMI0004743 (change log)
DescriptionBos taurus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

22 open access papers mention bta-mir-221
(59 sentences)

Stem-loop
   -----ccaaca       cuag   a    -  ug   u         auuu    -      
5'            uccaggu    ggc ugaa cc  gca acaauguag    cugu guuug 
              |||||||    ||| |||| ||  ||| |||||||||    |||| |||| u
3'            aggucca    ucg acuu gg  cgu uguuacauc    gaca cgagu 
   uucuugcacaa       ----   g    u  gu   c         ----    a      
Get sequence
Deep sequencing
136716 reads, 697 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 104688654-104688763 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-221
bta-mir-222chrX: 104687960-104688069 [+]
bta-mir-221chrX: 104688654-104688763 [+]
Database links

Mature sequence bta-miR-221

Accession MIMAT0003529
Sequence

65 - 

agcuacauugucugcuggguuu

 - 86

Get sequence
Deep sequencing127010 reads, 72 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).