Stem-loop sequence bta-mir-21

Accession MI0004742
Description Bos taurus miR-21 stem-loop
Gene family MIPF0000060; mir-21
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MIRN21. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene. MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u     gu        a     a     a    u a 
 gucgg  agcuuauc gacug uguug cugu g a
 |||||  |||||||| ||||| ||||| |||| | u
 caguc  ucggguag cugac acaac ggua c c
a     ug        -     g     -    - u 
Get sequence
Genome context
Coordinates (UMD3.1) Overlapping transcripts
chr19: 11033072-11033143 [+]
sense
Database links

Mature sequence bta-miR-21-5p

Accession MIMAT0003528
Previous IDs bta-miR-21
Sequence

8 - 

uagcuuaucagacugauguugacu

 - 31

Get sequence
Evidence experimental; cloned [1-3]
Predicted targets

Mature sequence bta-miR-21-3p

Accession MIMAT0003745
Previous IDs bta-miR-21*
Sequence

47 - 

aacagcagucgaugggcugucu

 - 68

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3