Stem-loop sequence bta-mir-18a

AccessionMI0004740 (change log)
DescriptionBos taurus miR-18a stem-loop
Gene family MIPF0000001; mir-17
Literature search

7 open access papers mention bta-mir-18a
(23 sentences)

Stem-loop
   u   cu    u   uc   u    a   -  aa u 
5'  guu  aagg gca  uag gcag uag ug  g a
    |||  |||| |||  ||| |||| ||| ||  | g
3'  cgg  uucc cgu  auc cguc auc ac  u a
   a   uc    u   ga   c    -   u  ga u 
Get sequence
Deep sequencing
4386 reads, 5.88 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 66421379-66421449 [+]
sense
ENSBTAT00000042226 ; bta-mir-18a-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-18a
bta-mir-17chr12: 66421236-66421319 [+]
bta-mir-18achr12: 66421379-66421449 [+]
bta-mir-19achr12: 66421518-66421599 [+]
bta-mir-20achr12: 66421687-66421757 [+]
bta-mir-19bchr12: 66421815-66421901 [+]
bta-mir-92a-1chr12: 66421937-66422014 [+]
Database links

Mature sequence bta-miR-18a

Accession MIMAT0003526
Sequence

6 - 

uaaggugcaucuagugcagaua

 - 27

Get sequence
Deep sequencing3974 reads, 67 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).