Stem-loop sequence bta-mir-16b

AccessionMI0004739 (change log)
Previous IDsbta-mir-16
DescriptionBos taurus miR-16b stem-loop
Gene family MIPF0000006; mir-15
Literature search

33 open access papers mention bta-mir-16b
(72 sentences)

Stem-loop
   caua     uc     u         ua        c  --    aa 
5'     cuugu  cgcug agcagcacg  aauauugg gu  agua  a
       |||||  ||||| |||||||||  |||||||| ||  ||||  u
3'     ggaca  gcgau ucgucgugu  uuauaacc ca  uuau  a
   --ag     gu     u         ua        a  aa    aa 
Get sequence
Deep sequencing
183393 reads, 2.13e+03 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 108321598-108321690 [-]
sense
ENSBTAT00000007705 ; SMC4-201; intron 5
ENSBTAT00000052946 ; SMC4-202; intron 5
Clustered miRNAs
< 10kb from bta-mir-16b
bta-mir-15bchr1: 108321741-108321838 [-]
bta-mir-16bchr1: 108321598-108321690 [-]
Database links

Mature sequence bta-miR-16b

Accession MIMAT0003525
Previous IDsbta-miR-16
Sequence

17 - 

uagcagcacguaaauauuggc

 - 37

Get sequence
Deep sequencing183034 reads, 76 experiments
Evidence experimental; cloned [1-3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3