Stem-loop sequence bta-mir-151

AccessionMI0004738 (change log)
DescriptionBos taurus miR-151 stem-loop
Gene family MIPF0000057; mir-28
Literature search

11 open access papers mention bta-mir-151
(26 sentences)

Stem-loop
       c            ca          c ucu 
5' ccug ccucgaggagcu  cagucuagua g   c
   |||| ||||||||||||  |||||||||| |    
3' ggac ggaguuccucga  gucagaucau c   a
       a            -a          c ccu 
Get sequence
Deep sequencing
368044 reads, 4e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 4090080-4090148 [+]
sense
ENSBTAT00000042244 ; bta-mir-151-201; exon 1
ENSBTAT00000012605 ; PTK2-202; intron 24
ENSBTAT00000064860 ; PTK2-201; intron 26
Database links

Mature sequence bta-miR-151-5p

Accession MIMAT0003523
Previous IDsbta-miR-151*
Sequence

8 - 

ucgaggagcucacagucuagu

 - 28

Get sequence
Deep sequencing178151 reads, 77 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence bta-miR-151-3p

Accession MIMAT0003524
Previous IDsbta-miR-151
Sequence

44 - 

cuagacugaagcuccuugagg

 - 64

Get sequence
Deep sequencing189893 reads, 77 experiments
Evidence by similarity; MI0000173
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).