miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0004736

Accession MI0004736
ID bta-mir-103-1
Description Bos taurus miR-103-1 stem-loop
Stem-loop 
cu   c  --    u  u           c   u g a 
  gcc uc  ggcu cu uacagugcugc uug u c u
  ||| ||  |||| || ||||||||||| ||| | |  
  cgg ag  ucgg ga auguuacgacg aac a g a
--   a  ua    -  c           -   u g u
Get sequence
Genome context
Coordinates (BTAU4.0) Overlapping transcripts
20: 2864127-2864198 [+]
sense
ENSBTAT00000015780 ; PANK3_BOVIN; intron 5
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0003521

Accession MIMAT0003521
ID bta-miR-103
Sequence

46 -  

agcagcauuguacagggcuauga

 - 68

Get sequence
Evidence experimental; cloned [1-2]
Predicted targets

References

1
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).