Stem-loop sequence bta-mir-101-2

AccessionMI0004735 (change log)
Previous IDsbta-mir-101
DescriptionBos taurus miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Literature search

14 open access papers mention bta-mir-101-2
(34 sentences)

Stem-loop
     ug  c                    c a    guaua 
5' ac  uc uuuuucgguuaucaugguac g ugcu     u
   ||  || |||||||||||||||||||| | ||||      
3' ug  gg aagaagucaauagugucaug c augg     c
     gu  u                    a -    aaagu 
Get sequence
Deep sequencing
213215 reads, 1.76e+03 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 40067392-40067470 [-]
sense
ENSBTAT00000042311 ; bta-mir-101-2-201; exon 1
ENSBTAT00000024840 ; RCL1-201; intron 8
Database links

Mature sequence bta-miR-101

Accession MIMAT0003520
Sequence

49 - 

uacaguacugugauaacugaa

 - 69

Get sequence
Deep sequencing426357 reads, 78 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2