Stem-loop sequence bta-let-7f-2

AccessionMI0004734 (change log)
Previous IDsbta-let-7f
DescriptionBos taurus let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

59 open access papers mention bta-let-7f-2
(235 sentences)

Stem-loop
   u      u   gu                uuagggucauac 
5'  guggga gag  aguagauuguauaguu            c
    |||||| |||  ||||||||||||||||             
3'  cacccu uuc  ucaucugacauaucaa            c
   g      -   ug                uagagguucuac 
Get sequence
Deep sequencing
6346858 reads, 2.96e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 97466644-97466726 [-]
sense
ENSBTAT00000008060 ; HUWE1-201; intron 60
Clustered miRNAs
< 10kb from bta-let-7f-2
bta-let-7f-2chrX: 97466644-97466726 [-]
bta-mir-98chrX: 97465740-97465858 [-]
Database links

Mature sequence bta-let-7f

Accession MIMAT0003519
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Deep sequencing12676347 reads, 78 experiments
Evidence experimental; cloned [1-3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3