|
miRBase |
|
miRBase has moved to http://www.mirbase.org/ - please update your links.
Stem-loop sequence MI0004734 |
||||||
| Accession | MI0004734 | |||||
| ID | bta-let-7f-2 | |||||
| Description | Bos taurus let-7f-2 stem-loop | |||||
| Stem-loop |
u u gu uuagggucauac guggga gag aguagauuguauaguu c |||||| ||| |||||||||||||||| cacccu uuc ucaucugacauaucaa c g - ug uagagguucuac |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Gene family |
MIPF0000002; let-7 |
|||||
Mature sequence MIMAT0003519 |
|
| Accession | MIMAT0003519 |
| ID | bta-let-7f |
| Sequence |
8 - ugagguaguagauuguauaguu - 29 |
| Evidence | experimental; cloned [1-3] |
| Predicted targets |
|
References |
|
| 1 |
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
| 2 |
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
| 3 |
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|