Stem-loop sequence bta-mir-29a

AccessionMI0004733 (change log)
DescriptionBos taurus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

31 open access papers mention bta-mir-29a
(129 sentences)

Stem-loop
               uuu       c    ucaa 
5' augacugauuuc   ugguguu agag    u
   ||||||||||||   ||||||| ||||    a
3' uauuggcuaaag   accacga ucuu    u
               ucu       -    uuaa 
Get sequence
Deep sequencing
170128 reads, 995 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 95726868-95726931 [-]
sense
ENSBTAT00000042263 ; bta-mir-29a-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-29a
bta-mir-29b-1chr4: 95727243-95727323 [-]
bta-mir-29achr4: 95726868-95726931 [-]
Database links

Mature sequence bta-miR-29a

Accession MIMAT0003518
Sequence

41 - 

cuagcaccaucugaaaucgguua

 - 63

Get sequence
Deep sequencing169971 reads, 77 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2