Stem-loop sequence ppt-MIR535d

Accession MI0004725
Description Physcomitrella patens miR535d stem-loop
Gene family MIPF0000136; MIR535
Stem-loop 
      a   a     a      cg      g    u   g 
ggugac acg gagag gcacgc  gaaugc uuca gca c
|||||| ||| ||||| ||||||  |||||| |||| ||| g
ccacug ugc cucuc cgugcg  cuugug aggu cgu a
      c   c     c      ag      g    c   g
Get sequence
Deep sequencing
7962 reads, 3 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (JGI1.1) Overlapping transcripts
scaffold_44: 180020-180104 [+]
intergenic

Mature sequence ppt-miR535d

Accession MIMAT0003915
Sequence

3 -  

ugacaacgagagagagcacgc

 - 23

Get sequence
Deep sequencing 7931 reads, 3 experiments
Evidence experimental; cloned [2], 454 [3]

References

1
PMID:16824179 "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T Plant J. 47:25-37(2006).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).