Stem-loop sequence ppt-MIR535d

AccessionMI0004725 (change log)
DescriptionPhyscomitrella patens miR535d stem-loop
Gene family MIPF0000136; MIR535
Literature search

2 open access papers mention ppt-MIR535d
(3 sentences)

Stem-loop
         a   a     a      cg      g    u   g 
5' ggugac acg gagag gcacgc  gaaugc uuca gca c
   |||||| ||| ||||| ||||||  |||||| |||| ||| g
3' ccacug ugc cucuc cgugcg  cuugug aggu cgu a
         c   c     c      ag      g    c   g 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr20: 10153735-10153819 [+]
intergenic
Database links

Mature sequence ppt-miR535d

Accession MIMAT0003915
Sequence

3 - 

ugacaacgagagagagcacgc

 - 23

Get sequence
Evidence experimental; cloned [2], 454 [3]

References

1
PMID:16824179 "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T Plant J. 47:25-37(2006).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).