|
miRBase |
|
Stem-loop sequence ppt-MIR533b |
|||||
| Accession | MI0004724 | ||||
| Description | Physcomitrella patens miR533b stem-loop | ||||
| Gene family | MIPF0000356; MIR533 | ||||
| Stem-loop |
-cc c - a c gac u ggagga gauauggagagcugu caggcugugaggg gagc cu guauucuuuu cu u |||||| ||||||||||||||| ||||||||||||| |||| || |||||||||| || g ucuccu cuaugucucucgaca gucugacacuccc cucg ga cauaagggag ga c ucu u u c - -aa u |
||||
| Deep sequencing |
| ||||
| Comments |
Axtell et al. show that mature products from both arms are significantly expressed [3], named here miR533b-5p and miR533b-3p. |
||||
| Genome context |
|
||||
Mature sequence ppt-miR533b-5p |
|
| Accession | MIMAT0003914 |
| Previous IDs | ppt-miR533b |
| Sequence |
17 - gagcuguccaggcugugaggg - 37 |
| Deep sequencing | 222 reads, 3 experiments |
| Evidence | experimental; cloned [3] |
Mature sequence ppt-miR533b-3p |
|
| Accession | MIMAT0004833 |
| Sequence |
90 - cucacagucuguacagcucuc - 110 |
| Deep sequencing | 6637 reads, 3 experiments |
| Evidence | experimental; 454 [3] |
References |
|
| 1 |
PMID:16824179
"Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss"
Plant J. 47:25-37(2006).
|
| 2 |
PMID:17359535
"Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution"
BMC Plant Biol. 7:13(2007).
|
| 3 |
PMID:17601824
"Common functions for diverse small RNAs of land plants"
Plant Cell. 19:1750-1769(2007).
|