|
miRBase |
|
Stem-loop sequence ppt-MIR1212 |
|||||
| Accession | MI0004711 | ||||
| Description | Physcomitrella patens miR1212 stem-loop | ||||
| Stem-loop |
g ug g c c g a - g c ua agga uugcau cu ugcugu cccac ugcg ucgu g g || |||| |||||| || |||||| ||||| |||| |||| | au uccu ggcgua ga acgaca gggug gcgc ggcg u c - gu a a u - c c g g |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence ppt-miR1212 |
|
| Accession | MIMAT0003901 |
| Sequence |
59 - cgugggacagcauagaaugcg - 79 |
| Deep sequencing | 5427 reads, 3 experiments |
| Evidence | experimental; Northern [1], cloned [2], 454 [3] |
References |
|
| 1 |
PMID:16824179
"Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss"
Plant J. 47:25-37(2006).
|
| 2 |
PMID:17359535
"Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution"
BMC Plant Biol. 7:13(2007).
|
| 3 |
PMID:17601824
"Common functions for diverse small RNAs of land plants"
Plant Cell. 19:1750-1769(2007).
|